Professional Dissertation Writing
Help in Australia

Targeting G-quadruplexes as novel anti-breast cancer strategies

 

ABSTRACT

The realization that G-quadruplex (G4) DNA structures are involved in transcriptional regulation and the maintenance of genome integrity has led to growing interest in their potential as cancer therapeutic targets. Herein, two separate strategies were undertaken with the aim of specifically targeting G4s to eventually regulate the transcriptional output of cancer-related genes. The first assessed the chromatin remodelling activity in a breast cancer cell line of three G4-stabilizing small molecules, GTC-365 and GTC-260 shown to have high specificity for the hTERT G4 and GQC-05 shown to have high specificity for the cMYC G4. The assay for transposase-accessible chromatin with sequencing (ATAC-Seq) was used to generate a library of tagmented genomic DNA following compound treatment in order to generate genome-wide maps of nucleosome depleted regions. Given that nucleosome positioning determines the ability of transcriptional machinery to access DNA, any chromatin remodelling activity by these small molecules could alter transcription. For the second G4-targeting anti-cancer strategy, a CRISPR-Cas9 system was designed with the aim of resetting the methylation status of G4s in the promoter region of specific oncogene and tumour suppressor genes in breast cancer cells. Alterations to genomic methylation patterns has been shown to influence the formation of G4s, and as these structures are important in gene regulation, changes to their formation could also impact the expression of genes.

Table of Contents

INTRODUCTION 3

MATERIALS AND METHODS 4

Assessing chromatin remodelling activity  4

CRISPR  7

RESULTS 9

DISCUSSION 11

REFERENCES 13

ACKNOWLEDGEMENTS 15

APPENDICES 15

 

INTRODUCTION

Breast cancer, the principal cause of cancer death among females globally (Torre et al., 2015), represents a major obstacle to public health. Despite survival rates doubling in the past 40 years in the UK, the fact that approximately 31 individuals die every day in the UK as a result of the disease (Cancer Research UK, 2016) demonstrates the acute need for more effective treatments. The pursuit of such novel treatments has led to the development of targeted therapies, including those that aim to target specific DNA regions or structures to prevent cancerous growth.

 

The commonly recognised structure of DNA is that of a duplex molecule in which two antiparallel strands are held together by Watson-Crick base pairing. However, it has been realised that DNA can undergo alternative base-pairing to form non-canonical secondary structures. Indeed, in certain guanine-rich regions of DNA it is possible for the formation of G-quadruplexes (G4s), four-stranded structures consisting of guanine bases stabilised by a central cation, to occur. Figure 1 depicts the G4 structure. The realization that these G4s are involved in transcriptional regulation(Gray et al., 2014) and the maintenance of genome integrity (Bochman, Paeschke and Zakian, 2012) has led to growing interest in their potential as cancer therapeutic targets (Monchaud and Teulade-Fichou, 2008; Yang and Okamoto, 2010; Vy Thi Le et al., 2012; Bidzinska et al., 2013; Ohnmacht et al., 2015). It is particularly their high abundance in regulatory, promoter and nucleosome depleted regions of the genome (Hänsel-Hertsch et al., 2016) that makes them such valuable targets for selectively reprogramming gene expression as an anticancer strategy.

Although numerous small molecules with high affinity for G4s have been reported and the molecular mechanisms of their G4-binding activity investigated, there is a need for greater understanding of the endogenous effects of these ligands within a cellular context. Indeed, it is thought that small molecule interactions with the genome are dependent on a dynamic interaction between the DNA code and chromatin states (Rodriguez and Miller, 2014). If G4-binding ligands are to achieve any clinical relevance, it is crucial that more is understood about the way in which they interact and impact the chromatin landscape of the human genome. Herein, the chromatin remodelling activity in the MCF-7 breast cancer genome of three G4-stabilizing small molecules, GTC-365 and GTC-260 shown to have high specificity for the hTERT G4⁸ and GQC-05 shown to have high specificity for the cMYC G4⁹, was measured.

It has also been realised that changes in DNA cytosine methylation (5-mC) can impact the formation of G4s, and that G4s in the oncogenic promoters of cancerous cells demonstrate altered methylation profiles. Therefore separately within this project, a CRISPR system was developed with the aim of resetting the methylation status of G4s in the promoters of specific oncogene and tumour suppressor genes in breast cancer cells. This was done in order to evaluate whether such changes in methylation could lead to altered gene expression, ultimately with the aim of halting the growth pathways and activating the death pathways of breast cancer cells.

MATERIALS AND METHODS

Assessing chromatin remodelling activity

Cell culture

MCF-7 cells were cultured in Minimum Essential Media  (Thermo Fisher, MEM , nucleosides, cat. no. 12571063) supplemented with 10% FBS (Thermo Fisher), in a humidified incubator at 37C and 5% CO₂. Cells were passaged every three days.

IC₅₀ values were calculated using the MTS Assay (CellTiter 96 AQ_ueous Cell Proliferation Assay, Promega). 2000 cells were seeded into each well of a 96 well plate and after overnight adhering, incubated for 72 h with 100 µL G4-stabilising compound at ten different concentrations ranging from 0.01 µM to 100 µM. 40 µL of tetrazolium dye was then added to each well and after 2 h incubation, optical density read at 490nm using the 2300 EnSpire Multimode Plate Reader. Background absorbance was accounted for by the use of triplicate ‘blank’ wells that did not contain cells but media and tetrazolium dye only. The results are shown as the concentration at which cell growth was prevented after the 72 h incubation period, expressed as a percentage of the controls. The IC₅₀ was calculated using linear regression analysis (GraphPad Prism).

According to the calculated IC₅₀ values, drug dilutions of appropriate concentrations were made up to a total of 10 ml in MCF-7 complete media. GQC-05 was diluted in complete media to a 0.3 µM solution, GTC-260 to a 3 µM solution and GTC-365 to a 20 µM solution. MCF-7 cells were seeded into 15 mm plates and allowed to adhere overnight. The following day, complete media was removed and for the control plate, replaced with 10 ml fresh complete media, whilst for each treatment plate replaced with 10 ml drug dilution. Plates were left for 72 hr to allow cells to reach 80% confluency.

After the drug incubation period, media was removed and all cell monolayers washed twice with 3 ml Phosphate Buffered Saline (PBS). Cell detachment was performed by addition of 3 ml TrypLE Select 1X (Thermo Fisher, cat no. 12563029) to each plate; these were incubated for 5 min at 37C. Cells were collected by centrifugation for 5 min at 200g and subsequently counted using a haemocytometer.

ATAC-seq

50,000 cells per reaction were used as input for the assay for Transposase-Accessible Chromatin with high-throughput sequencing (ATAC-seq). The assay was performed on each treatment type, including untreated controls, in duplicate according to Buenrostro et al (2015), but centrifuging samples for 5 min only at 500 x g and 4C once the cell pellet had been resuspended in 50 l cold lysis buffer. The quality of purified libraries was assessed using the Agilent 2200 TapeStation and quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems, kit code KK4824) on the LightCycler 480 Real-Time PCR System, according to manufacturer instructions. Libraries were sequenced using 50-bp paired end reads on the HiSeq2500 platform.

RNA-seq

Total RNA extraction from cells treated with each drug, and from untreated control cells, was performed using the Qiagen RNeasy Mini Kit (cat. no 74106), according to manufacturer instructions. In order to determine if the extracted RNA was sufficient for library preparation, samples were quantified using the Invitrogen Qubit 3 Fluorometer, according to manufacturer instructions. RNA-seq libraries were then prepared using the Illumia TruSeq Stranded Total RNA LT with Ribo-Zero Human Sample Preparation Kit (cat. no 20020597). Libraries were sequenced using 50-bp single reads on the HiSeq2500 platform.

Bioinformatics

Bioinformatic analysis of ATAC-seq data is currently being completed at the Garvan Institute of Medical Research. That of RNA-seq data is being sequenced by AGRF Bioinformatics. Image analysis is being carried out in real time using HiSeq Control Software v2.2.68 and Real Time Analysis v1.18.66.3. This performs real time base calling using the HiSeq instrument computer and the Illumina bcl2fastq 2.20.0.422 pipeline is used to produce sequence data.

CRISPR

Design of CRISPR-Cas9 constructs

A CRISPR-Cas9 system was developed to target alterations in DNA cytosine methylation present in breast cancer cells. Genes were chosen that contain a G4 demethylated region (G4-DMR) in their promoter and display abnormal transcriptional activity in breast cancer cells. This selection was achieved using MCF-7 whole genome maps of G4-DMR. The G4-DMR in the core promoter of the human telomerase reverse transcriptase catalytic subunit (hTERT) and that in the PDGFR gene were chosen. For each gene, potential guide RNA (gRNA) sequences of 17-18 base pairs (bp) in the target promoter were found using the crispr.mit.edu site and run on BLAT to ensure specificity to the target. The 60mer oligos of the sequences found to be specific to the target gene promoter were ordered from Integrated DNA Technologies (IDT) and extended at either end to produce 100bp double stranded DNA using Q5 Hot Start High-Fidelity 2X Master Mix and the following cycling conditions:

Step	Temperature	Time	10 cycles
Initial Denaturation	980C	2 minutes
Denaturation	980C	15 seconds
Annealing*	500C	20 seconds
Extension	720C	15 seconds

For AMPure purification of PCR products, twice the reaction volume of AMPure beads was added to PCR product and the solution vortexed then incubated for 5 min at room temperature (RT). Tubes were placed on a magnetic rack for 5 min and the supernatant was removed. Beads were washed twice for 30 s with 200 µL of 70% ethanol, ensuring complete removal of all ethanol each time. Tubes were microfuged and any residual ethanol removed. Beads were soaked for 1 min in 20 µL TE/10, and thoroughly mixed using a pipette. Tubes were incubated for 3 min at RT and then placed on a magnetic rack for 3 min. 19 µL of the supernatant was transferred to a new tube, and this diluted to 250 fmol in TE/10.  1 µg of gRNA cloning vector was digested with 0.3 µL of AflII and 20 units Shrimp Alkaline Phosphatase in a 50 μL reaction for 1 h. Tubes were incubated for 20 min at 65 ^oC to inactivate both enzymes. AMPure purification was carried out using one reaction volume of beads and eluting in 20 µL of TE/10. Nanodrop was used to quantitate the digestion. 250 fmol of gRNA, 10 fmol of the digested gRNA vector, and 1 X Gibson Assembly Master Mix were added to a microfuge tube and incubated for 1 hr at 50 ^oC. AMPure purification was performed again using 1 volume of beads but eluting in 10 µL of dH₂O. The top 10 competent cells were transformed using Gibson assembly product and plated onto LB Amp agar. A minimum of 4 transformants were selected for miniprep, and diagnostic restriction digest carried out on these.

Transfection of MCF-7 cells

The day before transfection, MCF-7 cells were seeded in complete media at 2.5 x 10⁵ per well. The next day, plasmid DNA (pDNA) stock was diluted in Milli-Q water to a 100 ng µL^-1 stock. 10 µL diluted pDNA was diluted in OptiMEM to a total 100 µL solution. 3 µL FuGENE HD was added directly into this solution and briefly vortexed. The tube was incubated for 15 min at RT and the solution then spread dropwise over the media. The plate was gently rocked back and forth to mix and incubated overnight at 37 ^oC and 5% CO_2. The following day, media and transfection mix were removed and replaced with complete media. The next day, EGFP expression was assessed using fluorescence-activated cell sorting (FACS).

 

Bisulphite conversion of transfected cells, amplification and sequencing

In order to establish the methylation profiles of DNA targets, bisulphite conversion was carried out using the Zymo Research EZ DNA Methylation-Direct Kit (cat no. D5020), according to manufacturer instructions and using transfected MCF-7 cells as the input material.

Prior to amplification and sequencing of the bisulphite converted DNA, four primer pairs were designed manually for both the hTERT and PDGFRβ DNA targets. These primers had to be in a 1000 bp region close to the guide target and, in order to amplify the bisulphite converted versions of both the demethylated and methylated sequences, had to avoid CpGs. Primers were designed and first tested on untransfected, but bisulphite converted, MCF-7 DNA in order to check for successful amplification. Successful primer pairs were used to amplify the transfected DNA.

qPCR analysis

Due to time constraints, qPCR analysis of the amplified DNA is now being undertaken by others. This analysis will assess the relative mRNA levels of the hTERT and PDGFRβ target genes was assessed using quantitative PCR, comparing transcription levels before and after transfection.

RESULTS

Figure 3 shows the cell viabilities of MCF-7 cells incubated separately with each of the three G4 stabilising ligands. The inhibitory activity of each of the ligands varied, as demonstrated by the IC₅₀ values.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Unfortunately, sequencing data for the chromatin remodelling project is currently unavailable as these results are still undergoing analysis. The CRISPR project is also being completed by others; qPCR is yet to be finished and therefore the final results cannot be reported here.

 

DISCUSSION

Although considerable research exists aiming to create new classes of G4-binding ligands or elucidate their G4-binding mechanisms, it is crucial to understand the chromatin-level changes induced by such ligands before their relevance in any clinical setting can be achieved. Whilst analysed sequencing data is not yet available, it is important to evaluate the methods used in this project and the challenges that were faced.

An important step prior to sequencing of ATAC-seq libraries was the evaluation of DNA quality in order to avoid wasted time and resources on degraded libraries that would not yield results. The 2200 TapeStation was chosen for this purpose as a more efficient method of quality control than the labour intensive traditional process of gel electrophoresis. Indeed, the TapeStation very rapidly analyses samples, reducing the time for the entire experiment to be carried out. Given that ATAC-seq was partially selected due to the fact that the protocol can be completed much faster than other methods that can provide information on chromatin accessibility, such as DNase I hypersensitive sites sequencing (DNase-seq), it was desirable to keep the time taken for downstream processes to a minimum.

After loading DNA libraries onto the 2200 TapeStation, the analysis software provides a gel image. It is thought that gels demonstrating a laddering pattern with periodicity of approximately 200 bp are indicative of intact chromatin that has undergone sufficient but not excessive tagmentation (Milani et al., 2016). The profiles in figure 4 exhibit such a pattern, which was used as evidence that the DNA from all samples was intact and that chromatin had been successfully tagmented. This, along with results from qPCR analysis that the quantity of DNA in each sample was adequate, led to the decision that all samples should be sequenced. Notably, fragments smaller than 100 bp are likely to be mitochondrial in origin and therefore were not considered in quality analysis.

Although these high-quality libraries were eventually produced, it should be realised that optimal tagmentation was not achieved immediately. Repeated ATAC-seq attempts led to either under- or over-tagmentation of DNA, with all such samples having to be abandoned. In order to optimise experiments, the ATAC-seq protocol was attempted with both fewer (25,000) and greater (75,000) cell numbers, but these changes did not improve results. However, when the experiment was carried out with fewer cells, under-tagmentation was observed in which fragments were overly long, whereas increasing cell numbers led to over-tagmentation in which the majority of fragments were too short and gel banding patterns were no longer visible. Lowering cell numbers did, nonetheless, provide the opportunity to optimise lysis conditions; centrifuging samples for 5 min only at 500 x g and 4C once the cell pellet had been resuspended in 50 l cold lysis buffer, rather than the suggested 10 min, led to the creation of high-quality libraries when the protocol was again attempted with 50,000 cells.

The other breast cancer treatment project, involving use of the CRISPR-Cas9 system, required the production of primers for the amplification and sequencing of bisulphite converted DNA. This was a particular challenge as the experiment aimed to target the hTERT and PDGFRβ promoter G4s, and promoter regions are characterised by containing a very high density of CpGs. It was therefore crucial to avoid all CpG regions when designing these primers, as they were intended for the amplification of bisulphite converted DNA; coverage of any CpGs would result in the methylated or unmethylated sequence being selectively amplified. Indeed, depending on whether a T or a C was selected in the primer where the CpG occurred, a 0 or 100% methylation result would be the output. Such skewed data would render any results obsolete.

Initially, several primer pairs were designed with the aim of amplifying a fragment of maximum 300 bp. However, it proved impossible to locate enough regions without CpGs, and therefore an approach that aimed to amplify one large fragment of approximately 1000 bp was used. This enabled searching for primers within a larger DNA region, which was advantageous because regions further from the G4-forming region are slightly less rich in CpGs. The primer design still had to be carried out by hand rather than using the online sites that tend to be routine, because online sites tended to fail to find any potential primer sites due to the density of CpGs in the area. Eventually, enough locations that were sparse in CpGs were located and primers were ordered and tested. These were tested initially on untransfected MCF-7 cells to prevent wastage of resources, and the two most successful primer pairs were chosen for further use.

This project entailed the broader problem of specificity of the CRISPR-Cas9 construct. Although off-target sequences were tested to check whether the construct could indeed bind to sites away from the intended hTERT or PDGFRβ G4 regions, it remains a possibility that untested sites could be affected by the system. Indeed, although next generation sequencing (NGS) can be used to assess the specificity of the CRISPR system, this cannot distinguish all DSBs as the local chromatin environment can greatly impact the efficiency of the non-homologous end joining (NHEJ) process (Zhang et al., 2014). Given that methylation is a prominent mechanism by which the genome regulates transcription, the idea that this CRISPR-Cas9 construct could even possibly alter the methylation status of unidentified similar sequenced sites is one that must be extensively addressed in future. Such research could include attempting to use a CRISPR construct with the Cpf1 nuclease, which has been discovered to be more specific, causing double strand breaks (DSBs) at fewer off-target sites than Cas9 (Kim et al., 2016; Kleinstiver et al., 2016).

 

The cost of breast cancer on society today, both financially and in human loss of life, necessitates the discovery of novel treatments that can produce fewer harmful side effects and better clinical outcomes. Research into the use of G4 stabilising ligands and a CRISPR-Cas9 system are clearly at their very early stages, but demonstrate efforts that will hopefully, in the future, be able to provide exactly this.

 

REFERENCES

Bidzinska, J., Cimino-Reale, G., Zaffaroni, N. and Folini, M., 2013. G-Quadruplex Structures in the Human Genome as Novel Therapeutic Targets. Molecules, 18(10), pp.12368–12395.

Bochman, M.L., Paeschke, K. and Zakian, V.A., 2012. DNA secondary structures: stability and function of G-quadruplex structures. Nature Reviews Genetics, 13(11), pp.770–780.

Cancer Research UK, 2016. Breast Cancer – UK Incidence Statistics [Online]. Available from: https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/breast-cancer#heading-Two [Accessed 2 September 2018].

Gray, L.T., Vallur, A.C., Eddy, J. and Maizels, N., 2014. G quadruplexes are genomewide targets of transcriptional helicases XPB and XPD. Nature Chemical Biology, 10(4), pp.313–318.

Hänsel-Hertsch, R., Beraldi, D., Lensing, S.V., Marsico, G., Zyner, K., Parry, A., Marco Di Antonio, Pike, J., Kimura, H., Narita, M., Tannahill, D. and Balasubramanian, S., 2016. G-quadruplex structures mark human regulatory chromatin. Nature Genetics, 48(10), pp.1267–1272.

Kim, D., Kim, J., Hur, J.K., Been, K.W., Yoon, S. and Kim, J.-S., 2016. Genome-wide analysis reveals specificities of Cpf1 endonucleases in human cells. Nature Biotechnology, 34(8), pp.863–868.

Kleinstiver, B.P., Tsai, S.Q., Prew, M.S., Nguyen, N.T., Welch, M.M., Lopez, J.M., McCaw, Z.R., Aryee, M.J. and Joung, J.K., 2016. Genome-wide specificities of CRISPR-Cas Cpf1 nucleases in human cells. Nature Biotechnology, 34(8), pp.869–874.

Milani, P., Escalante-Chong, R., Shelley, B.C., Patel-Murray, N.L., Xin, X., Adam, M., Mandefro, B., Sareen, D., Svendsen, C.N. and Fraenkel, E., 2016. Cell freezing protocol optimized for ATAC-Seq on motor neurons derived from human induced pluripotent stem cells. Scientific Reports, 5(6), pp.25474.

Monchaud, D. and Teulade-Fichou, M.-P., 2008. A hitchhiker’s guide to G-quadruplex ligands. Organic & Biomolecular Chemistry, 6(4), pp.627–636.

Ohnmacht, S.A., Marchetti, C., Gunaratnam, M., Besser, R.J., Haider, S.M., Di Vita, G., Lowe, H.L., Mellinas-Gomez, M., Diocou, S., Robson, M., Šponer, J., Islam, B., Barbara Pedley, R., Hartley, J.A. and Neidle, S., 2015. A G-quadruplex-binding compound showing anti-tumour activity in an in vivo model for pancreatic cancer. Scientific Reports, 16(5), pp.11385.

Rodriguez, R. and Miller, K.M., 2014. Unravelling the genomic targets of small molecules using high-throughput sequencing. Nature Reviews Genetics, 15(12), pp.783–796.

Torre, L.A., Bray, F., Siegel, R.L., Ferlay, J., Lortet-Tieulent, J. and Jemal, A., 2015. Global cancer statistics, 2012: Global Cancer Statistics, 2012. CA: A Cancer Journal for Clinicians, 65(2), pp.87–108.

Vy Thi Le, T., Han, S., Chae, J. and Park, H.-J., 2012. G-quadruplex binding ligands: from naturally occurring to rationally designed molecules. Current Pharmaceutical Design, 18(14), pp.1948–1972.

Yang, D. and Okamoto, K., 2010. Structural insights into G-quadruplexes: towards new anticancer drugs. Future Medicinal Chemistry, 2(4), pp.619–646.

Zhang, J.-H., Pandey, M., Kahler, J.F., Loshakov, A., Harris, B., Dagur, P.K., Mo, Y.-Y. and Simonds, W.F., 2014. Improving the specificity and efficacy of CRISPR/CAS9 and gRNA through target specific DNA reporter. Journal of Biotechnology, 189, pp.1–8.

ACKNOWLEDGEMENTS

This research was funded by the National Breast Cancer Foundation and the Cancer Council WA. Dr Nicole Smith, Prof Killugudi Swaminatha Iyer and Arnold Ou provided invaluable intellectual input. Many thanks to The University of Western Australia for the use of laboratory space that made this research possible.

 

APPENDICES

Appendix A

Personal Objectives and Learning Outcomes 1 (POLO 1)

Brief overview of the company/institute and department you are placed in:

I am working in the School of Molecular Sciences at the University of Western Australia, conducting research in Professor Killugudi Swaminatha Iyer’s laboratory.

Summary of your role and responsibilities:

As a placement student, I have been assigned research on two different projects, both revolving around the development of novel breast cancer therapeutics. The first project involves research into the use of small molecules to target G-quadruplexes that form in the promoter of genes involved in the development of breast cancer. In particular, we are currently working towards resolving the crystal structure of a particular G-quadruplex with an associated ligand. The second project is aiming to design a CRISPR system using TET-1 to demethylate specific DNA targets as a potential cancer therapeutic.

Summary of your current and upcoming work, projects, assignments:

Currently, I am undertaking multiple inductions so that I am able to independently use the laboratory’s equipment. For example, I have been inducted into the tissue culture lab, learning how to split and seed MCF-7 and MCF-10a cells as these are the cells that I will be working with. I am learning protocols for various processes such as qPCR, DNA extraction and quantification and ATAC-Seq. I will soon be inducted on the use of the confocal microscope, as my work will involve BG4 antibody imaging.

What are your overall expectations of the placement?

I expect that I will be required to quickly build on my repertoire of microbiological techniques so that I am able to provide meaningful data for both of my projects.

Which aspects of your degree do you hope to be able to use on your placement?

Both of my projects are genetics related, and so I am enjoying building on my existing genetics knowledge and improving my understanding of epigenetics. Having undertaken laboratory work during my degree, I am looking forward to using the techniques that I have learnt with greater independence and in a more ‘real’ scientific environment where results are genuinely unknown (despite the inevitable disappointment that this can entail!).

Biology and Biochemistry Principles, Practice & Achievement: The ability to apply an understanding of theoretical, methodological, empirical and practical knowledge and skill, to the solution of problems.  The ability to select and successfully apply appropriate principles, methods and techniques to placement tasks and reflect on their application.	Level of capability at start of placement:  2
Supporting statement/evidence: For ratings of 2 or above, enter a short statement describing why you have graded yourself at this level.
Laboratory work throughout the first two years of my degree has given me a grounding in some experimental techniques and an ability to apply knowledge in order to solve problems.
Personal development goals: Enter a short statement describing what goals you want to achieve in this capability area during your placement.
I definitely have a huge amount to learn and need to improve and increase the versatility of my laboratory skill set. At the moment I am still quite cautious when carrying out out laboratory tasks, so I would like to develop confidence in my ability to undertake tasks without the need to double check with my superiors that I am doing things correctly. I think that I could also improve in my ability to apply theory to the practical side of things; I know that I need to be able to better integrate my knowledge into lab work so that I always fully understand why I am doing something and therefore how I might be able to improve it.
How you will achieve these goals and any specific timescales set: Enter a short statement as to how you will achieve these development goals and the timescale in which you wish to have improved the capability and whether you will need any extra support to achieve this.
At the moment, I think that it is important that I continue to ask questions whenever possible so that I am able to absorb as much as possible. Everyone here at the lab has been incredibly willing to help and they are all very understanding that there is lots to learn at the start, and so I plan to continue learning from their advice. However, in order to develop my ability to undertake tasks without help, I have been starting to carry out protocols independently. I plan to continue developing this independence, and I hope that within the next month I will be confident in undertaking most of the routine protocols required by my project without assistance. In terms of applying theory to application, I have signed up to Google Scholar alerts for topics related to my work. I feel that staying up to date on existing research will help me to better understand my own research and therefore enable me to potentially see where I can optimise protocols and improve my methods.

Communication and Networking: The ability to communicate ideas by giving a complete and concise account of a situation in a variety of ways. (e.g. telephone conversations, participation in meetings, delivering presentations, written reports & documentation, liaising with personnel of different levels and forming a professional network of contacts.)	Level of capability at start of placement:  2
Supporting statement/evidence:
I feel that I am able to quite confidently communicate ideas to people of differing levels of authority in a variety of situations. This is particularly the result of working both in a restaurant, where I learnt to interact with customers of all ages, and also working as a Teaching and Outreach Ambassador for the University of Bath. Working as an Ambassador, I gained confidence speaking on the phone as a result of participating in a telephone calling campaign, and also developed my ability to liaise with staff at Outreach events.
Personal development goals:
I would like to improve my confidence when delivering presentations. Although I have given numerous presentations throughout my degree, I think that I could benefit from learning to speak to an audience with greater ease and without hesitation or the need for significant notes. I would also like to form a wider network of professional contacts, as this will be extremely useful in the future and may lead to further opportunities throughout the year.
How you will achieve these goals and any specific timescales set:
Weekly meetings with my supervisor will involve delivering presentations to the research group, covering the research I have conducted and my aims for the next week with a clear timescale set in which to achieve these. These will provide a good opportunity to enhance my presentation skills whilst also focussing me on how I can be most productive in the coming week. In terms of building a professional network, I am trying to ensure that I start conversations with many different people within the School of Molecular Sciences, extending my reach beyond merely the lab in which I am working. I also plan to attend any networking events or workshops that are on offer in order to gain further insight into the field generally, and to establish contacts in different areas. These aims will be ongoing throughout the year and so it is difficult to set a specific timescale as I don’t believe there will be a point when I will have ‘achieved’ them, but rather I hope that by the end of the year I will be able to say with satisfaction that I have done everything possible to attain better presentation skills and a wide network of professional contacts.

Teamwork: The ability to work well in a team, establish good relationships with colleagues, clients & suppliers. (e.g. effective listening, effective teamwork, ability to gain co-operation of others, negotiation, self-confidence.)	Level of capability at start of placement:  3
Supporting statement/evidence:
I think that I have quite effective team management skills having worked in a team many times, such as in sports teams, when delivering group presentations or cooperating efficiently with work colleagues.
Personal development goals:
I would like to improve my ability to negotiate confidently with others, offering my own opinion whilst listening to those of others. Having just started in this lab, I don’t think that I have been particularly out spoken as I am still finding my feet. I think that this is important at the beginning as I really am just learning, but as I gain confidence in the lab I want to gain greater confidence in speaking up, for example in group meetings.
How you will achieve these goals and any specific timescales set:
I will continue to listen to others around me in order to learn how they communicate effectively in this team environment, so that I begin adding my own contributions. As I start to do this, I think my self confidence will also increase.

Problem solving & Independent Learning: The ability to understand and interpret instructions, grasp new ideas and concepts, put forward innovative solutions, identify and adopt appropriate learning methods and strategies. (e.g. identify and analyse problems, evaluate solutions, and decision making).	Level of capability at start of placement:  2
Supporting statement/evidence:
Two years studying a Biology degree has undoubtedly improved my ability to grasp new ideas and also to analyse and evaluate problems in order to devise effective solutions.
Personal development goals:
Despite learning a great deal throughout my two years at university, I still think that I could vastly improve my problem solving ability. Although I think that I can often identify problems, I need to improve my ability to devise ways of overcoming these issues in new scenarios.
How you will achieve these goals and any specific timescales set:
I will gain a good understanding of any protocols that I am carrying out through reading journal articles so that I am in a well-informed position to identify issues and come up with ways of optimising the protocols. There is one protocol in particular, involving the identification of ligand binding sites, that has to date been unsuccessful and I will aim to innovate solutions to the existing problems.

Self-Management & Organisation: The ability to work independently, control and direct own training, take on responsibilities, understanding  importance of planning and scheduling, and having the flexibility to respond to changing circumstances. (e.g. organising own time, prioritising tasks, assuming leadership, using initiative, understanding impact of timescales, project planning, developing own work timelines and deadlines.)	Level of capability at start of placement:  3
Supporting statement/evidence:
I am a self-motivated individual and believe that I will work hard throughout this year to ensure that I take on responsibilities, enabling me to expand my knowledge and experience.
Personal development goals:
I need to ensure that I use my initiative rather than waiting to be told what to do, and that I prioritise tasks effectively to get the most important things done first. I think that I need to improve my ability to respond to changing situations with flexibility; this is particularly important in a laboratory environment, where results can often change the next required task.
How you will achieve these goals and any specific timescales set:
I have been learning to start ‘giving things a go’ once I understand the basics; I have realised that this is a really important way of developing skills, even if a few mistakes are made along the way. My supervisor encourages us to use timescales, and I think that this will really help me to improve my ability to prioritise tasks and complete them accordingly. I am also learning appropriate ways of adjusting to changing situations from those around me, and this will enable me to achieve my goal of responding to changes with greater flexibility.

Strategic Awareness: Understanding of the organisational vision and strategy, and how your work fits into the wider picture. (e.g. understanding the impact of your work within the company/sector, appreciation of the financial and budget implications of your tasks/project.)	Level of capability at start of placement:  2
Supporting statement/evidence:
I think it is hard not to recognise the importance of the work being done here in the lab, given its potential to make real contributions to, for example, medical advancements. I also realise that I cannot hope to ‘change the world’ during my year as a researcher at UWA, but I hope that I can make a real contribution to Nicole Smith’s projects while I am here.
Personal development goals:
I would like to gain greater insight into how the research world works and how the School ensures that it keeps pace with the scientific community at large. Although I am not involved in applying for grants, I think that it will be interesting to learn more about how this works in order to gain more of an appreciation of the process that allows research to continue.
How you will achieve these goals and any specific timescales set:
I will continue to stay up to date on the existing literature in the field so that I am able to identify possible implications of others’ research on our own. I will attend optional lectures in order to stay informed about what is going on within the School, and to gain greater insight into new ideas and ways of doing things. I will also ensure that I am actively involved with a variety of individuals within the School; this will enable me to learn from people at different levels, hopefully including those higher up who are involved in processes such as grant applications.

IT Skills: Knowledge of industry/sector-specific IT applications as well as general IT skills. (e.g. simulation software, design packages, database applications, financial applications, reporting & analysis tools, etc.)	Level of capability at start of placement:  1
Supporting statement/evidence:
I am proficient in the use of Excel, which is important for data analysis. I also have a basic grasp of BLAST software, which I will need for my research on the CRISPR project.
Personal development goals:
I need to improve my understanding of BLAST software, as this will be important for my research on the CRISPR project. I also need to learn to use microscopy imaging software.
How you will achieve these goals and any specific timescales set:
I have not yet had to use BLAST or microscopy imaging software, but as soon as these programmes become necessary for my project I will work hard to understand how to use them proficiently. I will build on my existing knowledge of BLAST using online tutorials and will ask colleagues for help if necessary. In mid- November I am attending an optional data analysis seminar and training, which I hope will improve my skills in these areas.

Appendix B

POLO Final

Biology and Biochemistry Principles, Practice & Achievement: The ability to apply an understanding of theoretical, methodological, empirical and practical knowledge and skill, to the solution of problems.  The ability to select and successfully apply appropriate principles, methods and techniques to placement tasks and reflect on their application.	Level of capability at end of placement:  4
Supporting statement/evidence: Outline the progress you have made within this capability area.
I have undertaken independent wet lab research throughout this year, which enabled me to greatly develop both my practical skill set and my ability to apply knowledge in order to solve problems with which I was faced. I developed my understanding of a wide variety of techniques, which led me to be able to select the appropriate method for achieving a particular end goal. I also learnt how to interpret the results of these methods. The more research that I carried out, the more I was able to develop my own confidence so that I no longer felt the need to ‘second guess’ myself. Additionally, it became habitual to read the existing literature in any area that I was carrying out research, and this enabled me to gain a fuller understanding of the work that I was doing.
Personal development goals: Enter a short statement providing a reflection on your progress, taking into account your previous POLO(s), and describe what future goals you want to achieve in this capability area.
I am proud of the progress that I have made, as I now feel able to confidently enter a lab environment and apply a wide array of methods to a particular task. The opportunity to run an independent project enabled me to realise that scientific research can be frustrating as experiments often do not produce the results you might have expected, but that it is about how you apply your knowledge to overcome these challenges. The fact that I was been able to spend so much time in the lab enabled me to gain a great deal of confidence, and this encourages me to want to further develop my skills. I would like not only to maintain but also further develop the skills and confidence that I have gained to better approach new laboratory tasks in the future (such as during my final year project), as these will likely be unrelated to the area that I have been working in.

Communication and Networking: The ability to communicate ideas by giving a complete and concise account of a situation in a variety of ways. (e.g. telephone conversations, participation in meetings, delivering presentations, written reports & documentation, liaising with personnel of different levels and forming a professional network of contacts.)	Level of capability at end of placement:  4
Supporting statement/evidence:
This year has given me a huge amount of practise in communication and networking, which I am incredibly grateful for. Presenting research updates at weekly group meetings ensured that I grew comfortable talking in front of an audience and learnt the more effective ways to convey my message. As I developed a greater understanding of my area of research and that of others in my lab group, I also become more confident at speaking out in these group meetings; a better knowledge basis meant that I had useful comments to add, for example if we were trying to solve the problems of any individual. The opportunity to attend three conferences (Lorne Cancer, the Australasian Society for Biomaterials and Tissue Engineering Conference, and the Australian Society for Medical Research Symposium) greatly improved my ability both to present and network. I attended many talks during these conferences, which enabled me to develop a greater understanding of what makes the best speakers. In addition, I carried out poster presentations at the Lorne and ASBTE conferences and gave oral presentations at the ASBTE and ASMR conferences. Presenting to many experienced scientists did seem daunting, particularly without any notes, but it enabled me to employ the presenting skills that I had learnt as well as gain valuable feedback. The conferences were also a great opportunity to meet and talk to a variety of professionals, enabling me to extend my network of contacts.
Personal development goals:
I would like to further improve my confidence when presenting, as I think that I need to learn to become more relaxed in front of the audience. The best presentations that I have seen are delivered in a very ‘natural’ manner, whereas any nerves or stiffness on the part of the presenter are quite noticeable to the audience. This is an area that I will aim to work on. I know that throughout final year I will be required to give numerous presentations, which will give me the opportunity to develop my skills in this area.

Teamwork: The ability to work well in a team, establish good relationships with colleagues, clients & suppliers. (e.g. effective listening, effective teamwork, ability to gain co-operation of others, negotiation, self-confidence.)	Level of capability at end of placement:  4
Supporting statement/evidence:
Having spent the year as a member of a laboratory group, I think that I became an integrated member of the team. I learnt the importance of listening to the needs of others in order to maintain a cohesive working group, and the value of honest communication in avoiding any misunderstandings. Although lab work tends to be fairly independent, the fact that we shared working space, equipment and materials meant that effective cooperation was crucial for the productivity of the whole group. I established good relationships with colleagues at a range of professional levels, which has contributed towards promoting a friendly working environment in which everyone could feel at ease.
Personal development goals:
I will aim to improve my ability to delegate, as I think that sometimes I can be too much of a perfectionist and refuse to recognise that balanced workloads are important in ensuring the satisfaction of all members of a team. Delegation was not particularly something that was required much throughout this year, as I was running an independent project for which I carried out the research. However, this does mean that I have not particularly developed in this area and in many work environments I think that it is will be a crucial skill.

Problem solving & Independent learning: The ability to understand and interpret instructions, grasp new ideas and concepts, put forward innovative solutions, identify and adopt appropriate learning methods and strategies. (e.g. identify and analyse problems, evaluate solutions, and decision making.)	Level of capability at end of placement:  4
Supporting statement/evidence:
Having begun my placement with only a relatively limited understanding of the area that I would be performing research, I think that I successfully grasped a whole range of new concepts. This broadening of my knowledge enabled me to understand the techniques that I was carrying out in order to solve problems as they arose.  Attending group meetings where we often discussed issues that individuals had been faced with really helped me to learn how others go about problem solving, and which of these methods tend to be most effective. At the beginning of my placement, I felt quite disheartened when things did not work in the way I might have wanted them to. However, I learnt that instead of getting frustrated it is much more productive to see these challenges as an opportunity to optimise protocols and develop a greater understanding of the processes (sometimes it can be too easy to just follow instructions without understanding the purpose of each step!).
Personal development goals:
I will aim to continue to improve my ability to troubleshoot problems, and it would also be useful to develop my analytical skills so that I am able to anticipate potential problems before they arise. By ensuring that I have a full understanding of a process, I will be better able to identify weaknesses in any given method and therefore perhaps avoid setbacks before they occur.

Self-Management & Organisation: The ability to work independently, control and direct own training, take on responsibilities, understanding importance of planning and scheduling, and having the flexibility to respond to changing circumstances. (e.g. organising own time, prioritising tasks, assuming leadership, using initiative, understanding impact of timescales, project planning, developing own work timelines and deadlines.)	Level of capability at end of placement:  4
Supporting statement/evidence:
I led my own independent research project this year, which very much required independent planning and scheduling. I enjoyed managing my time without being told precisely what to do and when, as I think that I thrive in an environment in which I am trusted to get things done in my own way. I learnt the importance of developing timelines to ensure that I was as productive as possible. Working in a research environment taught me to respond easily to changing circumstances, as just one unexpected result can totally alter what needs to be done. Furthermore, the arrival of new students ensured that I learnt to assume a leadership role when necessary, as the students required teaching.
Personal development goals:
I should improve my ability to prioritise tasks, as sometimes I can get carried away with the tasks that I enjoy the most rather than completing those that are most important first.

Strategic Awareness: Understanding of the organisational vision and strategy, and how your work fits into the wider picture. (e.g. understanding the impact of your work within the company/sector, appreciation of the financial and budget implications of your tasks/project.)	Level of capability at end of placement:  4
Supporting statement/evidence:
I ensure that I remain up to date with what is going on in the wider research community by regularly reading recently released papers. Although I tend to focus on papers that are relevant to my area of research, I also read the Nature news highlights in order to remain informed about important advancements outside of my own field. I place many orders for equipment and materials needed by the lab, and this has meant that I have gained an appreciation of where research money goes and where the greatest expenses lie. This has also given me an appreciation for the importance of respecting everything within the lab as research is extremely expensive; the more that is wasted away due to carelessness, the less will be available for more exciting purchases that could hugely benefit our ability to carry out cutting edge research.
Personal development goals:
I will aim to continue reading scientific papers in areas of interest once I have finished placement, as this broadening of my own knowledge will be useful both for final year at university and for potential job interviews.

IT Skills: Knowledge of industry/sector-specific IT applications as well as general IT skills. (e.g. simulation software, design packages, database applications, financial applications, reporting & analysis tools, etc.)	Level of capability at end of placement:  3
Supporting statement/evidence:
I have become more proficient in the use of Excel, particularly for data analysis. I have learnt to use Prism to analyse results and produce graphs. The need to present presentations and posters throughout the year has ensured that I have both improved my PowerPoint skills and taught myself basic Adobe Photoshop use. Designing primers has enabled me to learn how to navigate SnapGene and how to use several online tools such as BiSearch and MethPrimer. I now have a good understanding of how to use the UCSC genome browser, including Blat, and the Integrative Genomics Viewer (IGV), to analyse genetic sequences.
Personal development goals:
I would like to improve my understanding of statistical analysis software so that I can confidently evaluate data without seeking assistance. I also think that it would be very useful to widen my understanding of bioinformatics, particularly coding using R.

 

 

Appendix C

­­hTERT guides and off-targets

G-quadruplex and main methylation sites

5’–GGGGAGGGGCTGGGAGGGCCC⁷GGAGGGGGCTGGGCC⁸GGGGACCC⁹GGGAGGGGTC¹⁰GGGAC¹¹GGGGC¹²GGGG-3’

G-quadruplex in sequence

>hg19_dna range=chr5:1295000-1295490 5’pad=204 3’pad=219 strand=+ repeatMasking=none

GCCCTGGGGCCCCAGGCGCCGCACGAACGTGGCCAGCGGCAGCACCTCGCGGTAGTGGCTGCGCAGCAGGGAGCGCACGGCTCGGCAGCGGGGAGCGCGCGGCATCGCGGGGGTGGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCTGGGCGTCTGTGCCCGCGAATCCACTGGGAGCCCGGCCTGGCCCCGACAGCGCAGCTGCTCCGGGCGGACCCGGGGGTCTGGGCCGCGCTTCCCCGCCCGCGCGCCGCTCGCGCTCCCAGGGTGCAGGGAC

CRISPR search

GGCCGGGGCCAGGGCTTCCCACGTGCGCAGCAGGACGCAGCGCTGCCTGAAACTCGCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAGGGGCAGGACGGGTGCCCGGGTCCCCAGTCCCTCCGCCACGTGGGAAGCGCGGTCCT

Guide candidates

GCGCCGCGAGGAGAGGGCGGGGCCGCGGAAAGGAAGGGGAGGGGCTGGGAGGGCCCGGAGGGGGCTGGGCCGGGGACCCGGGAGGGGTCGGGACGGGGCGGGGTCCGCGCGGAGGAGGCGGAGCTGGAAGGTGAAG

Guide 55             >>>>>>>>>>>>>>>>>>+++

Guide 71                                                      >>>>>>>>>>>>>>>>>+++

Guide 41                                                                                                +++<<<<<<<<<<<<<<<<<

Guide 34                                                                     +++<<<<<<<<<<<<<<<<<<<

 

 

Final guide selection

Guides 55 (34%), 71 (23%), 41 (41%), 34 (49%)

 

Guide 55 34% gggccgcggaaaggaaggggAGG ..gccgcggaaaggaaggggAGG

Guide 71 23% gggggctgggccggggacccGGG …ggctgggccggggacccGGG

Guide 34 41% cgccccgtcccgacccctccCGG .gccccgtcccgacccctcccgg

Guide 41 49% ccagctccgcctcctccgcgCGG …gctccgcctcctccgcgcgg

 

Final guide oligos

Legend:

Bases removed from suggested guide

G forming part of the U6 promoter

Guide sequence, Reverse complement

PAM

5’ overhang for Gibson forward strand

5’ overhang for Gibson reverse strand

Completes U6 promoter

Completes sgRNA scaffold

Likely to be in gene promoter

Guide 55 (18+1 bp, extra G is a match = 19bp)

GGgccgcggaaaggaaggggAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCCGCGGAAAGGAAGGGG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCCCCTTCCTTTCCGCGGCC

Guide 71 (17+1 bp, extra G is a match = 18bp)

GGGggctgggccggggacccGGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGCTGGGCCGGGGACCC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGGTCCCCGGCCCAGCCC

Guide 41 (18+1 bp, extra G is a match = 19bp)

CGccccgtcccgacccctccCGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCCCCGTCCCGACCCCTCC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGAGGGGTCGGGACGGGGC

Guide 34 (17+1 bp, extra G is a match = 18bp)

CCAgctccgcctcctccgcgCGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTCCGCCTCCTCCGCG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGCGGAGGAGGCGGAGCC

 

Final guide checking using BLAT

Guide 55 (18+1 bp, extra G is a match = 19bp)

GGgccgcggaaaggaaggggAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCCGCGGAAAGGAAGGGG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCCCCTTCCTTTCCGCGGCC

GGACCGCGGACAGGAAGGGGTGG	4.1	2MMs [3:11]		chr21:-47158997	PCBP3, intron 2/13
GGGCCACGGAAAGGAAGGGTGGG	3.1	2MMs [6:20]		chr6:+157551676	–
GGGCCGCGGTGAGGAAGGGGCGG	2.7	2MMs [10:11]		chr20:-21502352	–
CGTCTGCGGAAAGGAAGGGGAAG	2.4	3MMs [1:3:5]  2MMs [3:5]	NM_005309	chr8:-145730604	GPT, intron 3/3 + exon 4/4  GPT, intron 4/5 + exon 5/6 GPT, intron 4/10 + exon 5/11
GGGGCGTGGTAAGGAAGGGGCAG	1.6	3MMs [4:7:10]		chr17:-43925839	–
GGGCAGGGGGAAGGAAGGGGCAG	1.6	3MMs [5:7:10]		chr8:-58961041	FAM110B, intron 3/4
CGGCCGCGAGAAGGAAGGGGCGG	1.5	3MMs [1:9:10]  2MMs [9:10]	NM_001128144	chr2:-190648764	ORMDL1, intron 1/4  ORMDL1, intron 1/3 Within 40bp of PMS1 TSS
GTGCCCCAGAAAGGAAGGGGAGG	1.5	3MMs [2:6:8]		chr17:+45962935	–
GAGCTGCGGAAAGGAAGGGTCAG	1.5	3MMs [2:5:20]		chr20:-23245547	–

Guide 71 (17+1 bp, extra G is a match = 18bp)

GGGggctgggccggggacccGGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGCTGGGCCGGGGACCC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGGTCCCCGGCCCAGCCC

GCGGGCTGGGCCGGGGACCCCAG	100.0	1MMs [2]  0MMs	NM_172082	chr7:-44364910	Highly likely to bind here  CAMK2B intron 1
AGGGGCTGCGCCGGGGACCCAGG	4.6	2MMs [1:9]  1MMs [9]	NM_000552	chr12:-6145513	VWF intron 19/51, VWF intron 16/17
AGGGGCTGGGCTGGGGACCCCGG	4.6	2MMs [1:12]  1MMs [12]		chr19:+35609510	FXYD3, intron 2  FXYD3, intron 3
AGTTGCTGGGCCGGGGACCCGAG	2.3	3MMs [1:3:4]  2MMs [3:4]	NM_002052	chr8:+11561677	GATA4, intron 2/2  GATA4, intron 2/6 Less that 20bp upstream of GATA4 TSS (2 isoforms of the gene)
GGGGGCGGGGCTGGGGACCCCGG	2.1	2MMs [7:12]		chr21:+45553288	Less that 300bp upstream of C21orf33 TSS
GGGCGCGAGGCCGGGGACCCAAG	1.7	3MMs [4:7:8]	NM_001168215	chr17:-48351868	TMEM92, exon 2/6 TMEM92, exon 1/5 (approx 130bp downstream from TMEM92 TSS)
GGGGGCTGGGCTGGGGACCAGAG	1.5	2MMs [12:20]		chr1:-9473146	–
AGGAGCTGGGCCGGGGACCGCGG	1.5	3MMs [1:4:20]  2MMs [4:20]		chr12:+28123665	PTHLH, intron 1/4  PTHLH, intron 1/3
CTGGGGTGGGCCGGGGACCCCAG	1.5	3MMs [1:2:6]  1MMs [6]	NR_040711	chr11:-2799142	KCNQ1, intron
CAGGGCTGGGCAGGGGACCCCGG	1.4	3MMs [1:2:12]  1MMs [12]		chr21:+46858320	COL18A1, intron 2/41
TGGTGCTGGGCTGGGGACCCGGG	1.4	3MMs [1:4:12]  2MMs [4:12]		chr7:-150798225	AGAP3, intron
GGGAGGTGGCCCGGGGACCCCGG	1.4	3MMs [4:6:10]		chr16:+80837431	CDYL2, intron 1/6
AGAGGCTGGGCTGGGGACCCAGG	1.4	3MMs [1:3:12]  2MMs [3:12]	NM_207411	chr8:-6669598	XKR5, exon 8/8
GGTGCCTGGGCGGGGGACCCAGG	1.3	3MMs [3:5:12]	NM_015122	chr19:-17889533	FCHO1, exon
GGCTGCTGGGCTGGGGACCCTGG	1.3	3MMs [3:4:12]		chr5:-173268051	–
AGTGGCTGGGCCGGGGGCCCAGG	1.3	3MMs [1:3:17]  2MMs [3:17]	NR_036467	chr12:+66508	IFFO1, intron 3/4  IFFO1, intron 4/5 IFFO1, intron 8/9

Guide 41 (18+1 bp, extra G is a match = 19bp)

CGccccgtcccgacccctccCGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCCCCGTCCCGACCCCTCC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGGAGGGGTCGGGACGGGGC

CGCCCCGTCCCGCCCCCTCCAGG	38.7	1MMs [13]	NM_020349	chr10:+99343309	Highly likely to bind here  ANKRD2, intron 8/8 + exon 9/9 ANKRD2, intron 7/7 + exon 8/8 CpG island, Approx 800bp upstream of the HOGA1 & PI4K2A TSS’s
CGCTTCTTCCCGACCCCTCCCAG	1.6	3MMs [4:5:7]		chr6:-26614519	–
CTCCCGGGCCCGACCCCTCCCGG	1.5	3MMs [2:6:8]	NM_005247	chr11:+69633418	FGF3, intron 1/2
CGCCCCTCCTCGACCCCTCCCAG	1.5	3MMs [7:8:10]		chr20:+62133365	–
TGCCCCGCCCCTACCCCTCCAGG	1.4	3MMs [1:8:12]  2MMs [8:12]	NM_006342	chr4:+1746415	TACC3, intron 14/15 + exon 15/16  TACC3, intron 13/14 + exon 14/15
GGCCCCGGCCCCACCCCTCCGGG	1.4	3MMs [1:8:12]  2MMs [8:12]	NM_022070	chr17:-58156004	HEATR6, intron 1/19
CGTCCCGCCCCCACCCCTCCCAG	1.3	3MMs [3:8:12]		chr20:+62478092	–
GGCCCCGCCCCGCCCCCTCCGGG	1.2	3MMs [1:8:13]  2MMs [8:13]		chr8:+104511035	–

Guide 34 (17+1 bp, extra G is a match = 18bp)

CCAgctccgcctcctccgcgCGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTCCGCCTCCTCCGCG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCGCGGAGGAGGCGGAGCC

CCAGGTCCTCCTCCTCCGCGCGG	3.7	2MMs [5:9]	NM_015441	chr1:-161993739	CpG island,  Within 100bp upstream of OLFML2B TSS
CCAGGTCGGACTCCTCCGCGGGG	2.3	3MMs [5:8:10]		chr1:-24882337	CpG island,  Within 300bp upstream of NCMAP TSS
CCAGCCCCGCCGCCTCCGCGCGG	2.0	2MMs [6:12]	NM_001002919	chr2:+287605	CpG island, approx. 200bp downstream of FAM150B TSS  FAM150B, exon 2/6 FAM150B, exon 1/5
CCAGCTCCACCTCCTCCGGGAAG	1.7	2MMs [9:19]		chr3:+52231673	Within 400bp of ALAS1 TSS
CCATCTTGGCCTCCTCCGCGCGG	1.7	3MMs [4:7:8]	NM_001916	chr8:-145149979	CYC1, exon 1/6  CYC1, exon 1/7 CpG island, within 30bp downstream of CYC1 TSS
CCAGCTCCGCCACCTCCGCTTAG	1.5	2MMs [12:20]		chr7:+73176273	–
CCTCCTCCACCTCCTCCGCGGAG	1.5	3MMs [3:4:9]  2MMs [4:9]	NM_203437	chr2:-64751495	AFTPH, exon 1/10  AFTPH, exon 1/9 Within 100bp downstream of AFTPH TSS
CCGGCCCCGACTCCTCCGCGGGG	1.4	3MMs [3:6:10]  2MMs [6:10]		chr22:-40390685	Within 300bp upstream of FAM83F TSS
CCGCCCCCGCCTCCTCCGCGGGG	1.4	3MMs [3:4:6]  2MMs [4:6]		chr6:-29600286	GABBR1, intron 1/22  GABBR1, intron 1/21
GCCCCTCAGCCTCCTCCGCGCGG	1.4	4MMs [1:3:4:8]  2MMs [4:8]	NR_003239	chr20:+37075364	–

 

Appendix D

PDGFRβ guides and off-targets

G-quadruplex in sequence

>hg19_dna range=chr5:149535450-149535650 5’pad=0 3’pad=0 strand=+ repeatMasking=none

450 CCCCACTTCC CCCGCCACTT TGGGGGAAAG GCTGCAGGGT GGCTTCTGAT

500 TGGCCCAGCT GGGAGAAGGG GGGGCGGCGG GGCAGGGAGG GTGGACGCGT

550 GCGTCTGTTT TCAATTTCAG TTTTTTTCCC CCTCTCTCTT TCTTTTCCCC

600 CAAGTTTCTT GTTTTTCTTC TTTTCACTCT GCTTACTCCC TCCCATCGCC C

Ideal guide region: 5480–5570

450 CCCCACTTCC CCCGCCACTT TGGGGGAAAG GCTGCAGGGT GGCTTCTGAT

500 TGGCCCAGCT GGGAGAAGGG GGGGCGGCGG GGCAGGGAGG GTGGACGCGT

550 GCGTCTGTTT TCAATTTCAG TTTTTTTCCC CCTCTCTCTT TCTTTTCCCC

600 CAAGTTTCTT GTTTTTCTTC TTTTCACTCT GCTTACTCCC TCCCATCGCC C

Final guide selection:

Guides 10 (63%), 11 (62%), 4 (73%), 16 (53%, backwards), 36 (18%)

 

Final guide oligos

Guide 10 (18+1 bp, extra G is a match = 19bp)

TGGCTTCTGATTGGCCCAGCTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTTCTGATTGGCCCAGC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGCTGGGCCAATCAGAAGCC

Guide 11 (17+1 bp, extra G is an overhang = 17bp)

GCTGCAGGGTGGCTTCTGATTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCAGGGTGGCTTCTGAT

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACATCAGAAGCCACCCTGCC

Guide 4 (18+1 bp, extra G is an overhang = 18bp)

CCCCCGCCACTTTGGGGGAAAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCCCGCCTCTTTGGGGGAA

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTTCCCCCAAAGAGGCGGGC

Guide 16 (17+1 bp, extra G is a match = 18bp)

CTGCAGCCTTTCCCCCAAAGTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCAGCCTTTCCCCCAAAG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCTTTGGGGGAAAGGCTGC

Guide 36 (17+1 bp, extra G is a match = 18bp)

TTGGGGGAAAAGAAAGAGAGAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGGGAAAAGAAAGAGAG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCTCTCTTTCTTTTCCCCC

Final guide checking using BLAT

Guide 10 (18+1 bp, extra G is a match = 19bp)

TGGCTTCTGATTGGCCCAGCTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCTTCTGATTGGCCCAGC

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACGCTGGGCCAATCAGAAGCC

TGGTTTCTGATTCGCCCAGCCAG	3.1	2MMs [4:13]	CLASP1 intron	chr2:-122116176
TGGATTCTGATTTGCCCAGCTAG	3.1	2MMs [4:13]	Nothing, no CpGs	chr9:+12242789
TGCCTTCTGATTGGTCCAGCTGG	2.7	2MMs [3:15]	MTFP1 intron; SEC14L2 exon	chr22:+30820006
TGGCTTCTGCTGGGCCCAGCTGG	2.5	2MMs [10:12]	Nothing, no CpG; slight signal in RNAseq map	chr6:+2360341

Guide 11 (17+1 bp, extra G is an overhang = 17bp)

GCTGCAGGGTGGCTTCTGATTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGCAGGGTGGCTTCTGAT

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACATCAGAAGCCACCCTGCC

ACTGCACTGTGGCTTCTGATTGG	1.8	3MMs [1:7:8]  2MMs [7:8]	SPAM1 intron	chr7:+123580161
As above	?	3MMs [1:7:8]  2MMs [7:8]	TMCO3 intron, methylated	chr13:+114186117
GCCGGAGGGTGGCTTCTGAACGG	1.4	3MMs [3:5:20]	Seems to be in a CpG island but very low MCF-7 methylation	chr11:-131170334
GCTGCAGGGTAGATTCTGATTGG	1.2	2MMs [11:13]	Nothing, no CpG	chr10:+33372465

Guide 4 (18+1 bp, extra G is an overhang = 18bp)

CCCCCGCCACTTTGGGGGAAAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCCCGCCACTTTGGGGGAA

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACTTCCCCCAAAGAGGCGGGC

CCTGCCCCACTTTGGGGGAAAAG	1.4	3MMs [3:4:6]	Nothing, no CpG	chr17:+25984780
CCCCAAACACTTTGGGGGAAGGG	1.0	3MMs [5:6:7]	FMN1 intron	chr15:-33249232

Guide 16 (17+1 bp, extra G is a match = 18bp)

CTGCAGCCTTTCCCCCAAAGTGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGCAGCCTTTCCCCCAAAG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCTTTGGGGGAAAGGCTGC

CTGCAGCCTTTTCCCCAAACAAG	1.5	2MMs [12:20]	Nothing	chr20:+36536577
GGGCAGCCTTTCCCCCAAATGAG	1.5	3MMs [1:2:20]	Nothing	chr1:-79807159
TTGCATCCTCTCCCCCAAAGGAG	1.5	3MMs [1:6:10]  2MMs [6:10]	FAT2 exon; far from promoter; some methylation	chr5:-150889614

Guide 36 (17+1 bp, extra G is a match = 18bp)

TTGGGGGAAAAGAAAGAGAGAGG

TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGGGGAAAAGAAAGAGAG

GACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACCTCTCTTTCTTTTCCCCC

TTGGGGGAAACGAAAGAGAGAAG	55.5	1MMs [11]	Highly likely will bind here  Nothing, low level transcription	chr8:+61932771
TTGGGGGAAAAGTAAGAGAGAGG	38.7	1MMs [13]	Highly likely will bind here  KCNH1 intron, quite a bit of transcription but 3.5kb away? Minimal methylation nearby	chr1:-211039117
CTGGGGGAAGAGAAAGAGAGGAG	7.4  ~60	2MMs [1:10]  1MM [10]	Highly likely will bind here  CLSTN3 intron, TSS+500bp RBP5, TSS-2kb Almost no methylation within 1kb though	chr12:-7283461
CTGGTGGAAAAGAAAGAGAGAAG	6.0  ~90	2MMs [1:5]  1MM [5]	Highly likely will bind here  Nothing, medium methylation	chr10:-88333710
GTGGGGGACAAGAAAGAGAGTGG	4.6  ~70	2MMs [1:9]  1MM [9]	Highly likely will bind here  Nothing, little methylation	chr6:-45671430
GTGGGGAAAAAGAAAGAGAGTAG	4.6  ~80	2MMs [1:7]  1MM [7]	Highly likely will bind here  ATG7 intron and exon, medium methylation, transcription, but not near promoter (TSS+25kb)	chr3:+11340508
TTGGGGGCAAAGAAAGAGACTAG	4.2	2MMs [8:20]	Nothing, some methylation	chr14:-66601534
TTGAGAGAAAAGAAAGAGAGTAG	3.3	2MMs [4:6]	PIBF1 intron, medium methylation	chr13:+73415163
TTGGGGGAGCAGAAAGAGAGAAG	2.9	2MMs [9:10]	CLASP1 intron, some methylation	chr3:+137461659

 

Appendix E

hTERT primers for bisulphite converted DNA amplification

Primer pair 1

1,187bp

 

Forward primer: GGGTTATTAGTTTTTTTAGGTAGG

• 24bp, Tm = 58.3C (salt adjusted), 33% GC
• chr5: 1,294,754 – 1,294,777

Native DNA:	ACTCGGGCCACCAGCTCCTTCAGGCAGGACAC  
Bisulphite converted DNA:	ATTCGGGTTATTAGTTTTTTTAGGTAGGATAT

Reverse primer: TCCATTTCCCACCCTTTCTC

• 20bp, 58.4C, 50% GC
• chr5: 1,295,919 – 1,295,938

Native DNA:	CGTCGAGAAAGGGTGGGAAATGGAGCCA  
Bisulphite converted DNA:	CGTCGAGAAAGGGTGGGAAATGGAGTTA
	<<<<<<<<<<<<<<<<<<<<<<<<

 

Primer pair 2

1,004bp

Forward primer: GATTATTGGGTTATGGATTATATG

• 24bp, 56.6C, 29% GC
• chr5: 1,294,934 – 1,294,957

Native DNA:	CACGCACACCAGGCACTGGGCCACCAGCGCG  
Bisulphite converted DNA:	TACGTATATTAGGTATTGGGTTATTAGCGCG
	<<<<<<<<<<<<<<<<<<<<<<<<<<

Reverse primer: CCATTTCCCACCCTTTCTC

• 19bp, 57.5C, 53% GC
• chr5: 1,295,919 – 1,295,937

Native DNA:	CGTCGAGAAAGGGTGGGAAATGGAGCCA  
Bisulphite converted DNA:	CGTCGAGAAAGGGTGGGAAATGGAGTTA
	<<<<<<<<<<<<<<<<<<<<<<

Primer pair 3

968bp

Forward primer: ATATTAGGTATTGGGTTATTAG

• 22bp, Tm = 52.7C, 27% GC
• chr5: 1,294,936 – 1,294,957

Native DNA:	ACGCACACCAGGCACTGGGCCACCAGCGCG  
Bisulphite converted DNA:	ACGTATATTAGGTATTGGGTTATTAGCGCG

Reverse primer: ATAAATAATTAACAAATTTAAAATAATTT

• 51.9C, 29bp, 3% GC
• chr5: 1,295,875 – 1,295,903

Native DNA:	GAGCAAACCACCCCAAATCTGTTAATCACCCACCGGG  
Bisulphite converted DNA:	GAGTAAATTATTTTAAATTTGTTAATTATTTATCGGG  <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

 

Primer pair 4

880bp

Forward primer: GTTAGTTTTGGGGTTTTAG

• 19bp, 50.9C, 37% GC
• chr5: 1,294,996 – 1,295,014

Native DNA:	AGCCGCCAGCCCTGGGGCCCCAGGCGC  
Bisulphite converted DNA:	AGTCGTTAGTTTTGGGGTTTTAGGCGT

Reverse primer: CTCATAATAAAAACCCCTC

• 19bp, 50.9C, 37% GC
• chr5: 1,295,855 – 1,295,873

Native DNA:	CGGCGAGGGGTCCCCACCATGAGCAAA  
Bisulphite converted DNA:	CGGCGAGGGGTTTTTATTATGAGTAAA  <<<<<<<<<<<<<<<<<<<<<

 

Appendix F

PDGFR primers for bisulphite converted DNA amplification

Primer pair 1

788bp

 

Forward primer: AGAGTGGGTAATAGTTGAGTAG

• 22bp, Tm = 58.4C, 41% GC

Native DNA:	TCCCAGAGTGGGTAACAGCTGAGTAGAAGG  
Bisulphite converted DNA:	TTTTAGAGTGGGTAATAGTTGAGTAGAAGG

Reverse primer: CACAAAAATAATCAAAATCTCCTTTAC

• 27bp, 59.2C, 26% GC

Native DNA:	ATCTGTAAAGGAGACTCTGATCATCTCTGTGGTTG  
Bisulphite converted DNA:	ATTTGTAAAGGAGATTTTGATTATTTTTGTGGTTG
	<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

Primer pair 2

765bp

 

Forward primer: GGATAGGTAGGATTGGTGTAGG

• 22bp, Tm = 62.1C, 50% GC

Native DNA:	AGAAGGACAGGCAGGACTGGTGCAGGCTCC  
Bisulphite converted DNA:	AGAAGGATAGGTAGGATTGGTGTAGGTTTTT

Reverse primer: CCACAAAAATAATCAAAATCTCCTTTAC

• 27bp, 61.5C, 29% GC

Native DNA:	ATCTGTAAAGGAGACTCTGATCATCTCTGTGGTTGA  
Bisulphite converted DNA:	ATTTGTAAAGGAGATTTTGATTATTTTTGTGGTTGAT
	<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

Primer pair 3

990bp

 

Forward primer: GAGAATAGAGGGATGGAGGAAG

• 22bp, Tm = 62.1C, 50% GC

Native DNA:	TCAGGAGAACAGAGGGATGGAGGAAGGGGG  
Bisulphite converted DNA:	TTAGGAGAATAGAGGGATGGAGGAAGGGGG

Reverse primer: ATCTTTCCATCTCCTCCATATCAC

• 24bp, 62C, 42% GC

Native DNA:	AGAGGTGACATGGAGGAGATGGAAAGATCCTC 
Bisulphite converted DNA:	AGAGGTGATATGGAGGAGATGGAAAGATTTTT
	<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<

 

Primer pair 4

848bp

 

Forward primer: GTATAGGTTGTTGTTGGGTAGTAG

• 24bp, Tm = 62C, 42% GC

Native DNA:	GCGAGCACAGGCTGCTGCTGGGCAGCAGGGCT  
Bisulphite converted DNA:	GCGAGTATAGGTTGTTGTTGGGTAGTAGGGTT

Reverse primer: ATCTTTCCATCTCCTCCATATCAC

• 24bp, 62C, 42% GC

Native DNA:	AGAGGTGACATGGAGGAGATGGAAAGATCCTC 
Bisulphite converted DNA:	AGAGGTGATATGGAGGAGATGGAAAGATTTTT
	<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<